Nexus format: If you are having trouble submitting a valid Nexus file, this page has some tips.
CIPRES Nexus Parser Statistics:
Current success rate: 73%
Rate of user file format errors: 27%
NEXUS files are notoriously difficult to parse, because there are so many formats that are used, and so many different ways to encode the information. Also, some programs are troubled by NEXUS that is not formally legal, while others are not. Mark Holder has led the CIPRES group's Nexus Parser program, based on the NCL program of Paul Lewis (soon to appear as Phycas). Philosopically, we have adhered to more strict standards, for the most part, because we beleive many relaxations of Nexus Standards can lead to inadvertant errors in the results set. In other words, you gave a command that was slightly different than the one you thought you gave.
If your NEXUS file is rejected please take a lok at the suggestions below. You can grab the documents in [doc] or [pdf] if that suits you better. We provide several different archetypal errors, each of them we have seen in one or more files submitted to the site. The examples show the full range of error messages one might encounter. If they are not sufficient, please let us know. The document for Nexus file formats is here [pdf].
Some Key Things to Know:
In the CIPRES portal, commands that would instruct PAUP from within Nexus are removed by the Parser. Soon there will be an interface that allows you to instruct PAUP at a finer grained level, but for now it is not possible.
The parser currently has trouble with new symbols, even if they are not used in the Nexus file. It is best to just remove the symbols, if possible.
Nexus Errors We Have Seen:
- Error Type 1. File type errors: 13 examples.
- Error Type 2. Parser problems: 4 examples
- Error Type 3. Misspellings, misplaced semi colons, etc: 12 examples
- Error Type 4. Taxon naming errors: 8 examples
- Error Type 5. Errors in GAP settings: 2 examples
- Error Type 6. Errors in state labels: 2 examples
- Error Type 7. Symbol Issues: 20 examples
- Error Type 8. Just plain illegal NEXUS: 5 examples
- Error Type 9. Problems executing: 2 examples*
Total files errors: 62
Possible parser errors: 9
Server issues*: 1
*Not reproducible
Error type 1. File type errors:
- Example 1. Fasta file: 10 times
Message: Nexus error in <filename>at line1:Expecting BEGIN and then a block name, but found > instead - Solution: Fasta files are not valid input.
- Example 2. .ss file : 3 times; .jpg one time
Message: Nexus error in file.ss at line1:Expecting BEGIN and then a block name, but found xread instead - Solution: We don’t handle Hennig86 yet. Please submit Phylip or Nexus files for now.
Error type 2. Parser problems:
Parser problems are errors in legal nexus that we can’t handle yet.
All examples so far are below.
- Example 1.
Message: Nexus error in <yourfile.nex> at line x:Expecting <someterm> name, but found <something else> instead
Here is a file that causes the message:
#NEXUS
log start filename=logfile;
Begin data;
Dimensions ntax=144 nchar=1159;
Format datatype=dna missing=? gap=-;
Matrix
Taxonname GCCATGCATGTAGTACTGCGGATGGCTCATTAAATCAGTTATAGTTTATTTGACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCGGATTCATTCAAATTTCTGCCCTATCAATCGTAACGGGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAATGGCTACCACTTCTAAGGAAGGCAGCAGGCGCGCAAATTACCCAATGAGGTAGTGACAATAAATAACAATACAATTGGAATGAGTACGAGTAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGCGTTTACCGTGA ;
End;
begin mrbayes;
set autoclose=yes;
lset nst=6 rates=gamma covarion=no;
mcmc ngen=10000000 printfreq=100 samplefreq=100 nchains=4 savebrlens=yes;
end;
log stop filename=logfile;
You must remove the lines in red to make it work. - Example 1b.
Message: Nexus error in <yourfile.nex> at line90:Expecting BEGIN and then a block name, but found exclude instead.
NNNNNNNNNNNNNNNNN;
End;
exclude 161-164;
[charset 12S = 1-11 1-354;]
[charset COIall = 355-1760;]
[charset COIpos1 = 355-1760\3;]
[charset COIpos2 = 356-1760\3;]
[charset COIpos3 = 357-1760\3;]
[begin mrbayes;]
Solution: we can't handle the exclude statement yet. You can remove the line shown in red from the file. but note that will change the results. - Example 1c.
Message: Nexus error in <yourfile.nex> at line2236:Expecting BEGIN and then a block name, but found pset instead.
ti97026????????????????????????????????.....???????????????????????????????????????
;
end;
pset gapmode=newstate;
Solution: remove the line shown in red from the file, but note that will change the results. - Example 2.
Message: Nexus error in <yourfile.nex> at line10:Could not read the value specified because NewTaxa = true was not specified before NTax (error in the NTax setting of the Dimensions command).Command Aborted.
The file has multiple character blocks in it. We do not support parsing multiple character blocks at this time.
Error type 3. Misspellings, misplaced semi colons, etc
- Example 1.
Message: Nexus error in test.nex at line984:Expecting BEGIN and then a block name, but found ; instead
At the end of the matrix the file looks like:
IARTSNEVEN QILTR--
;
end;
;
Solution: end; signifies the end of the file, but if there is another character, the program expects
begin <blockname>;
to fix this, remove the extraneous semicolon ; shown in red, after end; - Example 2.
A related problem produced this message:
Nexus error in <yourfile.nex> at line179:Expecting BEGIN and then a block name, but found #NEXUS instead
the extraneous word #Nexus was included, just remove it.
YYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY
;
End;
End;
#NEXUS
Begin trees; [Treefile saved Thursday, June 14, 2007 9:34 PM]
tree PAUP_2 = [&U] - Example 3.
Message: Nexus error in <yourfile.nex> at line1:Expecting BEGIN and then a block name, but found #NE instead
Misspelled first word of the file causes this error:
Just replace
#NE_US
With
#NEXUS - Example 4.
Message: Nexus error in <yourfile.nex> at line78:; is not a legal taxon name.
Solution: The taxon number supplied in the Nexus file is incorrect. In this case, ntax=70 was given, but the correct value is 69, hence the final semicolon is read as a taxa name.
To fix this, correct the number in the Dimensions block:
#NEXUS
Begin DATA;
Dimensions ntax=70 nchar=1402;
Format datatype=PROTEIN gap=-;
If instead, one ntax has fewer taxa than are present, this message will appear:
Nexus error in <yourfile.nex> at line24:; was expected, but Osh15 was entered. - Example 5.
Message: Nexus error in <yourfile.nex> at line7:Unexpected c in Dimensions command. Command Aborted.
Issue: extraneous character in the command block.
BEGIN DATA; DIMENSIONS c NCHAR=1482; FORMAT DATA
Remove the character c in the dimension block. - Example 6.
Message: Nexus error in <yourfile.nex> at line7:Unexpected c in Dimensions command. Command Aborted.
Taxon1 AATTTCTCAACTCTGA-GCTC---GG-ATGAGGGGCTTCCCTTGAAATAT
Taxon2 AATTTCTCAACTCTGAAGCTT---GGGATGAGGGGCTTCCCTTGAAATAT
Taxon3 AATTTCTCAACTCTGAAGCTT---GG-ATGAGGGGCTTCCCTTGAAATAT
Taxon4 AATTTCTCAACTCTGAAGCTT---GG-ATGAGGGGCTTCCCTTGAAATAT
Taxon5 AATTTCTCAACTCTGAAGCTT---GG-ATGAGGGGCTTCCC(CT)TTGAAATAT
Taxon6 AATTTCTCAACTCTGA-GCTT---GG-ATGAGGGGCTTCCCTTGAAATAT
Solution: The line showed in bold caused the error. The (CT) character means this is either C or T. This is legal, but it masks that fact that an extra nucleotide has been inserted. You can see that by removing the character.
Taxon1 AATTTCTCAACTCTGA-GCTC---GG-ATGAGGGGCTTCCCTTGAAATAT
Taxon2 AATTTCTCAACTCTGAAGCTT---GGGATGAGGGGCTTCCCTTGAAATAT
Taxon3 AATTTCTCAACTCTGAAGCTT---GG-ATGAGGGGCTTCCCTTGAAATAT
Taxon4 AATTTCTCAACTCTGAAGCTT---GG-ATGAGGGGCTTCCCTTGAAATAT
Taxon5 AATTTCTCAACTCTGAAGCTT---GG-ATGAGGGGCTTCCCTTTGAAATAT
Taxon6 AATTTCTCAACTCTGA-GCTT---GG-ATGAGGGGCTTCCCTTGAAATAT
- Example 7.
Message: Nexus error in <yourfile.nex> at line251:State specified (1) for taxon 245, character 1, not found in list of valid symbols.
Taxon1 GCAGGATTAACTGCATTTTATATGTTTCGAATCTACTTACTTGTTTTT
Taxon2_2 GCAGGATTAACTGCATTTTATATGTTTCGAATCTACTTACTTGTTTTT
Taxon3 1 GCAGGATTAACTGCATTTTATATGTTTCGAATCTACTTACTTGTTTTT
Taxon4 GCAGGATTAACTGCATTTTATATGTTTCGAATCTACTTACTTGTTTTT
Solution: The stored label. Taxon3 1 is illegal, because there is a white space, so the one is taken as the first character.
Error Type 4. Taxon naming errors: 8 examples
- Example 1.
Message: Nexus error in <yourfile.nex> at line5455:Could not find taxon named Acharagma aguirreana among stored taxon labels
Solution: This is simply a typing error on the part of the user. The stored label Acharagma aguirreana was spelled as Acharagma aquirreana. Just check your spelling and do a global replacement in your editor. - Example 2.
Message: Nexus error in <yourfile.nex> at line105:Data for this taxon (subpictus) has already been saved
In this example, the Taxons defined were genusA and genusB, but in the matix, the A and B labels were lost, making the taxons appear identical.Just repair the file so the two taxa have different names.
Error Type 5. Errors in GAP settings: 2 examples
- Example 1.
Message: Nexus error in <yourfile.nex> at line7:the GAP character and MISSING character cannot be identical.
Solution: These two flags cannot be represented by the same symbol.
Find this flag;
FORMAT DATATYPE=DNA MISSING=? GAP=?
Then replace the character that represents one character state or the other. You must make this change relevant within the data set when you change the flags or the results will be meaningless. - Example 2. Illegal Gap characters
Message: Nexus error in <yourfile.nex> at line7:GAP character cannot be whitespace (including _) or any of the following: ()[]{}/\,;:=*'"`^
You have used an illegal character to represent gap state. Please use a legal character, like -
Error Type 6. Errors in state labels: 2 examples
- Example 1.
Message: Nexus error in <yourfile.nex> at line42:- is an illegal CharLabels for character number 13.
Solution: Don’t use the hyphen, use the underscore for Charlabels; - Example 2.
Message: Nexus error <yourfile.nex> at line752:The StateLabels for a character must be unique (( was repeated).
Solution: Don’t use parens when creating state labels;
Error Type 7. Symbol Issues: 20 examples
- Example 1.
Message: Nexus error in <yourfile.nex> at line6:the SYMBOL A is already in the symbols list; Nexus error in ITS <yourfile.nex> at line6:the SYMBOL B is already a default equate code for this DATATYPE
#NEXUS
BEGIN DATA;
dimensions ntax=28 nchar=1183;
format missing=?
symbols="ABCDEFGHIKLMNPQRSTUVWXYZ"
interleave datatype=DNA gap= -;
matrix
Solution: Datatypes such as DNA have an implicit symbol list. Re-specification of these symbols is not permitted. Remove the Symbols list shown in red
- Example 2.
Message: Nexus error in <yourfile.nex> at line36:State specified (X) for taxon 28, character 164, not found in list of valid symbols
This file fails because the character X, found in the Matrix, is not defined, and is not among the explicitly defined characters for protein.
#NEXUS
Begin DATA;
Dimensions ntax=92 nchar=1293;
Format datatype=PROTEIN gap=-;
Matrix
Solution: If the character X happens to stand for missing data, you can fix the problem by adding a definition for X.
#NEXUS
Begin DATA;
Dimensions ntax=92 nchar=1293;
Format datatype=PROTEIN missing=X gap=-;
Matrix - Example 3.
Message: Nexus error in <yourfile.nex> x at line336:State specified (E) for taxon 1, character 1, not found in list of valid symbols
begin characters;
dimensions nchar= 137;
Matrix
Solution: This file lacked a format statement/datatype definition, so all character states were undefined. Insert the line in red below; taking care to define all symbols (see Example 2).
begin characters;
dimensions nchar= 137;
Format datatype=PROTEIN missing=. gap=-;
Matrix - Example 4.
Message: Nexus error in <yourfile.nex> at line6:State specified (1) for taxon 1, character 12, not found in list of valid symbols
#NEXUS
begin data;
dimensions ntax=13 nchar=44;
format missing=? symbols="0~3";
matrix
Solution: This file fails because the symbols statement is invalid. Nexus expects the symbols statement to be of the format “ followed by the symbol values, separated by a white space, followed by a “. The correct statement is shown below in red:
#NEXUS
begin data;
dimensions ntax=13 nchar=44;
format missing=? symbols="0 1 2 3 ";
matrix - Example 5.
Message: The tree infer service encountered an error and was unable to obtain a starting tree.
These files load, but return the error message above. The issue in each case is the declaration of symbols that are not of the data type submitted, or the presence of an symbol not recognized by the parser. New symbols are not tolerated well by any of the programs, and even a declaration of symbols that aren’t there causes a failure.
This file has no new symbols in the matrix, although it declares them (legally):
#NEXUS
BEGIN DATA;
DIMENSIONS NTAX=71 NCHAR=1152;
FORMAT DATATYPE=PROTEIN SYMBOLS = " 1 2 3 4" MISSING=? GAP=- ;
MATRIX
This file is corrected by striking out the section highlighted in red, which will not affect the results.
Error Type 8. Just plain illegal NEXUS
- Example 1.
Message: Nexus error in ITS <yourfile.nex> at line735:Expecting BEGIN and then a block name, but found charpartition instead
;
end;
charpartition genes=ITS:1-617, LSU:618-.;
hompart partition=genes nreps=1000 seed=123
search=bandb; - Example 2.
Message: Nexus error in <yourfile.nex> at line22:Expecting BEGIN and then a block name, but found ctype instead
Congosaurus 11???1?1???1????1??1110111????1100??21?110??
CNRSTSUNY278 ??1?1????00?0????1????????100?????0???1?????
;
end;
ctype ord: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 ;
begin trees ;
tree tnt_1 = [&U]
(1,(3,(2,(4,(9,((13,(8,(5,(7,(6,12))))),(10,11)))))));
tree tnt_2 = [&U] - Example 3.
Message: Nexus error in <yourfile.nex> at line9:State specified (o) for taxon 1, character 54, not found in list of valid symbols
For some reason, the parser sees taxon2 line 2 (Taxon 4) as a continuation of line 1 (Taxon2).
#NEXUS
BEGIN DATA;
dimensions ntax=4 nchar=121;
format missing=?
datatype=DNA gap= -;
matrix
Taxon2 GACGGTT-TTGTAGTACC-GAAATGCTGTTTTGACGGTCTTATCAGTGCG
Taxon4 -TTGGTCCTTTTTGAGCC-GCAAGGCTCTATTGAGAGCCTTAGCGGTGAG
Taxon3 -GCAGTCCCTCCATCGTC-ACCGCTGTTTAGCGCGGGCCTTCGTGGCTTC
This problem is usually caused when the nchar value is incorrect. - Example 4.
Message: Nexus error in <yourfile.nex> DNA sequences at line331:Could not read the value specified because NewTaxa = true was not specified before NTax (error in the NTax setting of the Dimensions command).Command Aborted
This file has a taxa block, but the characters block also has an ntax statement in the Dimensions command. This implies that the characters block is introducing new taxa. In NEXUS, new taxa must be introduced explicitly:
dimensions newtaxa ntax= 322 nchar= 411;
instead of
dimensions ntax= 322 nchar= 411;
In this particular case, the ntax has not changed relative to the taxa block, so new taxa need not be introduced at this point. Instead. the ntax statement should be removed from the character block :
#NEXUS
[ Title : <yourfile.nex>]
begin taxa;
dimensions ntax= 322;
taxlabels
E_histolytica2.1.
E_histolytica2.2….etc
subsequently, the character line
X_tropicalis4.4.
;
end;
begin characters;
dimensions ntax= 322 nchar= 411;
format missing=? gap=- matchchar=. datatype=DNA;
matrix
[!Domain=Data property=Coding CodonStart=1;]
You can just leave out the ntax statement; so the dimensions command of the characters block can simply be:
dimensions nchar= 411;
E_histolytica2.1.
E_histolytica2.2….etc
Error Type 9. Problems executing: 2 examples
- Example1.
Message: RAxML:Server-side Exception: connection timeout of 1000 milliseconds expired
These errors are related to traffic levels, and were not reproducible

